Brown Bear - PDFSEARCH.IO - Document Search Engine

Brown Bear
Results: 787

#	Item
101	Microsoft Word - Final report IBA.doc Add to Reading List Source URL: www.bearbiology.com Language: English - Date: 2011-09-28 14:35:08 Political geography Bear Brown bear International Bear Association Ursus Albania OTE Bears Zoology Fauna of Europe
102	female European brown bear Ursus arctos having a nap in Kočevska in Northern Dinaric Mountains Slovenia Add to Reading List Source URL: washington.veleposlanistvo.si Language: English - Date: 2015-02-11 15:25:54 Prešeren Day Kočevska Reka Ljubljana Prešeren Award Ciril Zlobec Peter Kozler Pahor Europe Slovenia France Prešeren
103	Bear Baiting Seasons and Requirements July 1, [removed]June 30, 2014 Bear bait stations may be established in certain areas, all bait stations must be registered at ADF&G and all persons who wish to register a bait site mu Add to Reading List Source URL: www.adfg.alaska.gov Language: English - Date: 2014-03-21 14:29:30 Animal rights Bait Decoys Bear-baiting Grizzly Bear Kenai Fishing bait Brown bear Zoology Bears Biology
104	Ancestry of polar bears traced to Ireland Add to Reading List Source URL: phys.org Language: English - Date: 2015-02-10 18:13:08 Fauna of Europe Polar bear Brown bear Arctic Hybrid Cave bear Grizzly bear Bears Zoology Biology
105	Additonal file 4. Table S3 The average pairwise nucleotide and amino-acid distances (A), dN and dS for brown bear MHC class I sequences (B). Distances and standard error values are given as percentages per site; standar Add to Reading List Source URL: www.biomedcentral.com Language: English Amino acid Matter Genes Genetics Pseudogene
106	Additional file 2. Supplementary information. Mammalian MHC sequences used to obtain the brown bear sequences used to design primers. Mammalian MHC sequences used to obtain the brown bear sequences used to design primer Add to Reading List Source URL: www.biomedcentral.com Language: English Glycoproteins M. fascicularis MHC class II A. melanoleuca MHC class I Class II Macaque Sarcocystis: Host-parasite relations Biology Immune system Genes
107	Additional file 5. Nucleotide sequences of MHC class II DRB genes in the Scandinavian brown bear. >Urar-DRB11 GTGCGGTACCTGGTCAGAGACATCTATAACGGGCAGGAGAACGTGCGCTTCGACAGCGACGTGGGGGAGTTCCGGGCGGTGACGGAGCTGGGGCGGCCCATCGCTGA Add to Reading List Source URL: www.biomedcentral.com Language: English*
108	Original language: English CoP16 Prop. XXX CONVENTION ON INTERNATIONAL TRADE IN ENDANGERED SPECIES OF WILD FAUNA AND FLORA Add to Reading List Source URL: www.cites.org Language: English - Date: 2013-09-10 16:21:39 Fauna of Europe Polar bear Brown bear Arctic Baffin Bay Chukchi Sea International Agreement on the Conservation of Polar Bears Polar ecology Zoology Bears Biology
109	L A Defense of Life or Property Game Animal Kill Report Add to Reading List Source URL: fire.ak.blm.gov Language: English - Date: 2014-06-17 19:37:08 Scavengers Meat industry Animal cruelty Hunting Livestock Brown bear Grizzly bear Animal trapping Gray wolf Zoology Bears Biology
110	CABINET-YAAK GRIZZLY BEAR RECOVERY AREA 2006 RESEARCH AND MONITORING PROGRESS REPORT Add to Reading List Source URL: www.igbconline.org Language: English - Date: 2015-01-08 17:24:17 Fauna of Europe Grizzly bear Brown bear American black bear Grizzly Bears Zoology Biology

UPDATE